Review



450 dinb  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    ATCC 450 dinb
    450 Dinb, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/450+dinb/pK5/10__1128_slash_aem__72__2__1569___1578__2006-103-61-76
    Average 90 stars, based on 6 article reviews
    450 dinb - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Multiple-Locus Sequence Typing Analysis of Bacillus cereus and Bacillus thuringiensis Reveals Separate Clustering and a Distinct Population Structure of Psychrotrophic Strains
    Article Snippet: .. Primers used for PCR amplification Locus Genome positiona (kb) Primer 1b Primer 2b Area used foranalysisc (nt) clpC 90 5 GTACGCGAAGGTGAAGGAATTGC 3 5 ATGCATC(G/A)ATTGCACCTTC(T/C)GC(T/C)C 3 151–650 purF 300 5 (C/T)GAAGAATGTGGCGTTTT(C/T)GGAA(/T)(/T) 3 5 GAAATACTAGAGTCTGGTACACCAG 3 101–700 gdpD 574 5 GGTGGTTATGCAAATGCGAC(A/G)AATG 3 5 (C/T)GCCATAATATAAAATGG(C/T)GTCACG 3 101–600 yhfL 1068 5 GCGAAACCTCATCAGATTTTA(A/C)(C/T)C 3 5 CAGGTACTTCTTCCCCAAGTTCAT 3 101–600 panC 1484 5 CGATA(T/C)CC(T/A)CGTGATATTGATAGAG 3 5 TC(C/A)GCATAATCTACAGTGCCTTTC 3 101–450 dinB 4103 5 GAGGCGAGAGAATA(C/T)GGAATACG 3 5 (G/T)CCCATTTGA(C/T)TCGGATC(C/A)ACT(/T)(/C)(/C) 3 101–500 a In the B. cereus ATCC 14579 genome sequence (17). b Letters in parentheses show T and W cluster-specific sequences. c From primer 1. on January 19, 2015 by U C S F Library & C K M http://aem .asm .org/ D ow nloaded from (17, 29) gave no PCR amplification for many cluster W strains (not shown). ..

    Amplification:

    Article Title: Multiple-Locus Sequence Typing Analysis of Bacillus cereus and Bacillus thuringiensis Reveals Separate Clustering and a Distinct Population Structure of Psychrotrophic Strains
    Article Snippet: .. Primers used for PCR amplification Locus Genome positiona (kb) Primer 1b Primer 2b Area used foranalysisc (nt) clpC 90 5 GTACGCGAAGGTGAAGGAATTGC 3 5 ATGCATC(G/A)ATTGCACCTTC(T/C)GC(T/C)C 3 151–650 purF 300 5 (C/T)GAAGAATGTGGCGTTTT(C/T)GGAA(/T)(/T) 3 5 GAAATACTAGAGTCTGGTACACCAG 3 101–700 gdpD 574 5 GGTGGTTATGCAAATGCGAC(A/G)AATG 3 5 (C/T)GCCATAATATAAAATGG(C/T)GTCACG 3 101–600 yhfL 1068 5 GCGAAACCTCATCAGATTTTA(A/C)(C/T)C 3 5 CAGGTACTTCTTCCCCAAGTTCAT 3 101–600 panC 1484 5 CGATA(T/C)CC(T/A)CGTGATATTGATAGAG 3 5 TC(C/A)GCATAATCTACAGTGCCTTTC 3 101–450 dinB 4103 5 GAGGCGAGAGAATA(C/T)GGAATACG 3 5 (G/T)CCCATTTGA(C/T)TCGGATC(C/A)ACT(/T)(/C)(/C) 3 101–500 a In the B. cereus ATCC 14579 genome sequence (17). b Letters in parentheses show T and W cluster-specific sequences. c From primer 1. on January 19, 2015 by U C S F Library & C K M http://aem .asm .org/ D ow nloaded from (17, 29) gave no PCR amplification for many cluster W strains (not shown). ..

    Sequencing:

    Article Title: Multiple-Locus Sequence Typing Analysis of Bacillus cereus and Bacillus thuringiensis Reveals Separate Clustering and a Distinct Population Structure of Psychrotrophic Strains
    Article Snippet: .. Primers used for PCR amplification Locus Genome positiona (kb) Primer 1b Primer 2b Area used foranalysisc (nt) clpC 90 5 GTACGCGAAGGTGAAGGAATTGC 3 5 ATGCATC(G/A)ATTGCACCTTC(T/C)GC(T/C)C 3 151–650 purF 300 5 (C/T)GAAGAATGTGGCGTTTT(C/T)GGAA(/T)(/T) 3 5 GAAATACTAGAGTCTGGTACACCAG 3 101–700 gdpD 574 5 GGTGGTTATGCAAATGCGAC(A/G)AATG 3 5 (C/T)GCCATAATATAAAATGG(C/T)GTCACG 3 101–600 yhfL 1068 5 GCGAAACCTCATCAGATTTTA(A/C)(C/T)C 3 5 CAGGTACTTCTTCCCCAAGTTCAT 3 101–600 panC 1484 5 CGATA(T/C)CC(T/A)CGTGATATTGATAGAG 3 5 TC(C/A)GCATAATCTACAGTGCCTTTC 3 101–450 dinB 4103 5 GAGGCGAGAGAATA(C/T)GGAATACG 3 5 (G/T)CCCATTTGA(C/T)TCGGATC(C/A)ACT(/T)(/C)(/C) 3 101–500 a In the B. cereus ATCC 14579 genome sequence (17). b Letters in parentheses show T and W cluster-specific sequences. c From primer 1. on January 19, 2015 by U C S F Library & C K M http://aem .asm .org/ D ow nloaded from (17, 29) gave no PCR amplification for many cluster W strains (not shown). ..



    Similar Products

    450 dinb  (ATCC)
    90
    ATCC 450 dinb
    450 Dinb, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/450+dinb/pK5/10__1128_slash_aem__72__2__1569___1578__2006-103-61-76
    Average 90 stars, based on 1 article reviews
    450 dinb - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results